Original article
Promoter hypermethylation of DNA repair genes MLH1 and MSH2 in adenocarcinomas and squamous cell carcinomas of the lung
Hipermetilação Promotora de Genes Reparadores de DNA MLH1 e MSH2 em Adenocarcinomas e Carcinomas de Células Escamosas do Pulmão
Read
1150
Timeswas read the article
619
Total PDF
531
Total HTML
Share statistics
array:25 [ "pii" => "S2173511514000104" "issn" => "21735115" "doi" => "10.1016/j.rppnen.2013.07.007" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "173" "copyright" => "Sociedade Portuguesa de Pneumologia" "copyrightAnyo" => "2012" "documento" => "article" "crossmark" => 0 "licencia" => "http://www.elsevier.com/open-access/userlicense/1.0/" "subdocumento" => "fla" "cita" => "Rev Port Pneumol. 2014;20:20-30" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 3135 "formatos" => array:3 [ "EPUB" => 260 "HTML" => 1947 "PDF" => 928 ] ] "Traduccion" => array:1 [ "en" => array:20 [ "pii" => "S0873215913001037" "issn" => "08732159" "doi" => "10.1016/j.rppneu.2013.07.003" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "173" "copyright" => "Sociedade Portuguesa de Pneumologia" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Rev Port Pneumol. 2014;20:20-30" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 9815 "formatos" => array:3 [ "EPUB" => 277 "HTML" => 8226 "PDF" => 1312 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Promoter hypermethylation of DNA repair genes MLH1 and MSH2 in adenocarcinomas and squamous cell carcinomas of the lung" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "20" "paginaFinal" => "30" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Hipermetilação Promotora de Genes Reparadores de DNA MLH1 e MSH2 em Adenocarcinomas e Carcinomas de Células Escamosas do Pulmão" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1801 "Ancho" => 1500 "Tamanyo" => 798578 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">MLH1 IHC expression in one mixed type adenocarcinoma, (A) basel cell hyperplasia, (B) acinar pattern with reduced expression (−), (C) bronchioloalveolar pattern with normal expression (+++) and (D) solid pattern with reduced expression (++); MSH2 IHC expression in epidermoid carcinoma in situ and (E) corresponding epidermoid carcinoma (F) 200×.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "A. Gomes, M. Reis-Silva, A. Alarcão, P. Couceiro, V. Sousa, L. Carvalho" "autores" => array:6 [ 0 => array:2 [ "nombre" => "A." "apellidos" => "Gomes" ] 1 => array:2 [ "nombre" => "M." "apellidos" => "Reis-Silva" ] 2 => array:2 [ "nombre" => "A." "apellidos" => "Alarcão" ] 3 => array:2 [ "nombre" => "P." "apellidos" => "Couceiro" ] 4 => array:2 [ "nombre" => "V." "apellidos" => "Sousa" ] 5 => array:2 [ "nombre" => "L." "apellidos" => "Carvalho" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2173511514000104" "doi" => "10.1016/j.rppnen.2013.07.007" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173511514000104?idApp=UINPBA00004E" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0873215913001037?idApp=UINPBA00004E" "url" => "/08732159/0000002000000001/v2_201509041402/S0873215913001037/v2_201509041402/en/main.assets" ] ] "itemSiguiente" => array:20 [ "pii" => "S2173511513001012" "issn" => "21735115" "doi" => "10.1016/j.rppnen.2013.06.006" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "178" "copyright" => "Sociedade Portuguesa de Pneumologia" "documento" => "article" "crossmark" => 0 "licencia" => "http://www.elsevier.com/open-access/userlicense/1.0/" "subdocumento" => "sco" "cita" => "Rev Port Pneumol. 2014;20:31-5" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 4042 "formatos" => array:3 [ "EPUB" => 251 "HTML" => 2549 "PDF" => 1242 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Brief communication</span>" "titulo" => "Association between respiratory mechanics and autonomic function in morbid obesity" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "31" "paginaFinal" => "35" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2535 "Ancho" => 2451 "Tamanyo" => 227458 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Associations between respiratory mechanics and heart rate variability variables. SDNN: standard deviation of RR intervals; rMSSD: root mean square of successive differences between adjacent normal RR intervals; R0: resistance extrapolated to 0<span class="elsevierStyleHsp" style=""></span>Hz; R5: resistance at 5<span class="elsevierStyleHsp" style=""></span>Hz; Rm: mean resistance.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "M. Sant’ Anna Junior, R.F. Carvalhal, J.R.I. Carneiro, M.S. Lapa, W.A. Zin, J.R. Lugon, F.S. Guimarães" "autores" => array:7 [ 0 => array:2 [ "nombre" => "M." "apellidos" => "Sant’ Anna Junior" ] 1 => array:2 [ "nombre" => "R.F." "apellidos" => "Carvalhal" ] 2 => array:2 [ "nombre" => "J.R.I." "apellidos" => "Carneiro" ] 3 => array:2 [ "nombre" => "M.S." "apellidos" => "Lapa" ] 4 => array:2 [ "nombre" => "W.A." "apellidos" => "Zin" ] 5 => array:2 [ "nombre" => "J.R." "apellidos" => "Lugon" ] 6 => array:2 [ "nombre" => "F.S." "apellidos" => "Guimarães" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "pt" => array:9 [ "pii" => "S0873215913001086" "doi" => "10.1016/j.rppneu.2013.06.009" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "pt" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0873215913001086?idApp=UINPBA00004E" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173511513001012?idApp=UINPBA00004E" "url" => "/21735115/0000002000000001/v1_201401230023/S2173511513001012/v1_201401230023/en/main.assets" ] "itemAnterior" => array:20 [ "pii" => "S2173511513000985" "issn" => "21735115" "doi" => "10.1016/j.rppnen.2013.04.002" "estado" => "S300" "fechaPublicacion" => "2014-01-01" "aid" => "156" "copyright" => "Sociedade Portuguesa de Pneumologia" "documento" => "article" "crossmark" => 0 "licencia" => "http://www.elsevier.com/open-access/userlicense/1.0/" "subdocumento" => "fla" "cita" => "Rev Port Pneumol. 2014;20:12-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 6754 "formatos" => array:3 [ "EPUB" => 262 "HTML" => 4935 "PDF" => 1557 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Obese patients: Respiratory complications in the post-anesthesia care unit" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "12" "paginaFinal" => "19" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Doentes obesos: complicações respiratórias na unidade pós-anestésica" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "J. Mendonça, H. Pereira, D. Xará, A. Santos, F.J. Abelha" "autores" => array:5 [ 0 => array:2 [ "nombre" => "J." "apellidos" => "Mendonça" ] 1 => array:2 [ "nombre" => "H." "apellidos" => "Pereira" ] 2 => array:2 [ "nombre" => "D." "apellidos" => "Xará" ] 3 => array:2 [ "nombre" => "A." "apellidos" => "Santos" ] 4 => array:2 [ "nombre" => "F.J." "apellidos" => "Abelha" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "pt" => array:9 [ "pii" => "S0873215913000548" "doi" => "10.1016/j.rppneu.2013.04.002" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "pt" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0873215913000548?idApp=UINPBA00004E" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173511513000985?idApp=UINPBA00004E" "url" => "/21735115/0000002000000001/v1_201401230023/S2173511513000985/v1_201401230023/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Promoter hypermethylation of DNA repair genes MLH1 and MSH2 in adenocarcinomas and squamous cell carcinomas of the lung" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "20" "paginaFinal" => "30" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "A. Gomes, M. Reis-Silva, A. Alarcão, P. Couceiro, V. Sousa, L. Carvalho" "autores" => array:6 [ 0 => array:3 [ "nombre" => "A." "apellidos" => "Gomes" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 1 => array:3 [ "nombre" => "M." "apellidos" => "Reis-Silva" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 2 => array:3 [ "nombre" => "A." "apellidos" => "Alarcão" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "P." "apellidos" => "Couceiro" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 4 => array:3 [ "nombre" => "V." "apellidos" => "Sousa" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 5 => array:4 [ "nombre" => "L." "apellidos" => "Carvalho" "email" => array:1 [ 0 => "lcarvalho@huc.min-saude.pt" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">¿</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Department of Anatomical Pathology, University Hospitals of Coimbra, Portugal" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "CIMAGO, Faculty of Medicine, University of Coimbra, Portugal" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Institute of Anatomical Pathology, Faculty of Medicine, University of Coimbra, Portugal" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Hipermetilação Promotora de Genes Reparadores de DNA MLH1 e MSH2 em Adenocarcinomas e Carcinomas de Células Escamosas do Pulmão" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1802 "Ancho" => 1501 "Tamanyo" => 767764 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">MLH1 IHC expression in one mixed type adenocarcinoma, (A) basel cell hyperplasia, (B) acinar pattern with reduced expression (−), (C) bronchioloalveolar pattern with normal expression (+++) and (D) solid pattern with reduced expression (++); MSH2 IHC expression in epidermoid carcinoma in situ and (E) corresponding epidermoid carcinoma (F) 200×.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Epigenetics of human cancer has been overshadowed by human cancer genetics since 1983. Increasingly visible with a growing understanding of specific epigenetic mechanisms and their role in cancer,<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> the modifications refer to a number of molecular mechanisms that regulate gene expression without changing DNA sequence<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>: (1) alteration of methylation status of DNA within CpG islands (the main human epigenetic modification)<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a>; (2) covalent modification of histone tails; (3) gene regulation by micro-RNA (miRNA).</p><p id="par0010" class="elsevierStylePara elsevierViewall">While early embryonic cells lack methylation (as it is not transmitted via the germline), methylation is essential for the development and regulation of gene expression and controls expression of oncofetal genes in postnatal life by imprinted genes and tissue-specific gene expression.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> This perfect equilibrium in normal cells is transformed in cancer cells. DNA methylation is believed to contribute to cancer initiation and progression by gene inactivation. This can have important consequences if the inactivated genes are essential for the control of normal cell growth, differentiation, or apoptosis.<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> The mechanisms that regulate normal and aberrant methylation are neither fully understood nor are the mechanisms of methylation that interfere with transcription.<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">The mismatch DNA repair (MMR) system is composed of a few well-conserved proteins. The essential components of MMR system, MutS, MutL, MutH and Uvr, were identified in <span class="elsevierStyleItalic">Escherichia coli</span>. In addition, all eukaryotic organisms, including humans, have MutS homologs and MutL homologs. The MLH1 and MSH2 genes provide instructions for making a protein that plays an essential role in DNA repair. These proteins fix mistakes that are made when DNA is copied (DNA replication) in preparation for cell division. The MLH1 protein joins with another protein, the PMS2, to form an active protein complex. This protein complex coordinates the activities of other proteins that repair errors during DNA replication. The repairs occur by removing the section of DNA and replacing it by a correct DNA sequence. The MSH2 protein joins with one of the two other proteins, the MSH6 protein or the MSH3 protein, to form an active protein complex. This active protein complex identifies places on the DNA where mistakes have been made during DNA replication.</p><p id="par0020" class="elsevierStylePara elsevierViewall">The prognosis of lung cancer is very limited by the difficulties of diagnosing early stage disease amenable to surgery. Only 10% of cases can benefit from local treatment with long-term survival. Despite much progress in the treatment and detection methods of lung carcinoma, the prognosis remains poor. This situation is mainly the result of metastases which are present in more than two-thirds of patients at the time of diagnosis.<a class="elsevierStyleCrossRefs" href="#bib0025"><span class="elsevierStyleSup">5,6</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">The objectives of our study were to characterize the expression of DNA repair proteins MLH1 and MSH2 in tumour tissue, precursor lesions, respiratory epithelia and parenchyma of 80 clinically well-characterized NSCLC patients and also to study the methylation status of two DNA repair genes – <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span>, to correlate between the methylation status of the promoters of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span>, and their respective protein expression and clinicopathological parameters.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Patients and tissue samples</span><p id="par0030" class="elsevierStylePara elsevierViewall">All biopsy and resection specimens were reviewed by the Pathology Department of the University Hospital of Coimbra, to verify non-small cell histology of the lung cancer samples and to determine the histologic subtype. Histological subtypes consisted of 80 cases of surgically staged pulmonary carcinomas as well as corresponding non-neoplastic and pre-neoplastic tissue of adenocarcinomas and squamous cell carcinomas of the lung.</p><p id="par0035" class="elsevierStylePara elsevierViewall">Twenty-four females and 16 males with adenocarcinoma (ADC), and 36 males and 4 females with squamous cell carcinoma (SCC) were confirmed according to the latest World Health Organization Classification of Lung Cancer (2004).<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> The average age was 64.9<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>9.88 years at the time of diagnosis.</p><p id="par0040" class="elsevierStylePara elsevierViewall">The TNM staging was applied according to the 2010 TNM Classification of Malignant Tumours, 7th Edition<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a>: thirty-nine patients had Stage I disease, 19 had Stage II and 9 had stage III.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Tissue microarrays building</span><p id="par0045" class="elsevierStylePara elsevierViewall">Representative areas of carcinoma, preneoplastic lesion and normal bronchial epithelium and parenchyma, were carefully selected from the haematoxylin-eosin slide, and marked respectively in each slide and the each formalin-fixed, paraffin-embedded block of tissue. Tissue microarrays of 3<span class="elsevierStyleHsp" style=""></span>mm were performed in triplicate in tumour and normal respiratory epithelium and in a single core for preneoplastic lesion, included on the same slide.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Analysis of protein expression: immunohistochemistry</span><p id="par0050" class="elsevierStylePara elsevierViewall">IHC satins for hMLH1 and hMLH2 were performed on 3<span class="elsevierStyleHsp" style=""></span>μm thick sections cut from paraffin-embedded TMAs blocks. Commercially available antibodies against these markers were used as per manufacturer's protocols. Monoclonal antibodies used were (clone ZM001, 1:200, Zymed) for MLH1and (clone FE11, 1:40, Zymed) for MSH2, using the Streptavidin–Biotin Horseradish Peroxidase method. Epitope retrieval using microwave heat or steam pre-treatment was performed as required. Normal endometrium was used as positive control. The normal staining pattern for both MLH1 and MSH2 is nuclear. Lymphocytes and normal bronchial epithelium were used as internal positive control as follow: Normal expression (>75%/+++); Reduced expression: Negative (≤10%/−) and Positive (>10–50%/+ or 50–75%/++).</p><p id="par0055" class="elsevierStylePara elsevierViewall">Following the explained score it was possible to define two definite groups, the positive when present +++/75% nuclear expression and the group with reduced expression. Staining results were examined without knowledge of the status of the molecular analyses.</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Methylation-specific polymerase chain reaction assay for the hMLH1 and hMSH2 genes</span><p id="par0060" class="elsevierStylePara elsevierViewall">For DNA extraction, areas from all the slides corresponding to the principal histological patterns were selected. The tumour-rich areas were manually micro-dissected. Five 10<span class="elsevierStyleHsp" style=""></span>μM sections were cut from the paraffin blocks corresponding to the already selected areas and deparaffined by xylene extraction. The resulting tissue pellets were digested with Proteinase K at 56<span class="elsevierStyleHsp" style=""></span>°C overnight. The genomic DNA was isolated using QIAamp DNA MiniKit according to the manufacturer’ protocol (Qiagen, Valencia, CA). By spectrophotometry (Nanodrop ND1000, Thermo Scientific, USA) the purity and concentration of the samples were verified.</p><p id="par0065" class="elsevierStylePara elsevierViewall">The promoter methylation status of the <span class="elsevierStyleItalic">MLH1</span> gene of all tumour samples and of the <span class="elsevierStyleItalic">MSH2</span> gene of tumour samples was determined by chemical treatment with sodium bisulfite and subsequent methylation-specific PCR (MSP) analysis as described.<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a></p><p id="par0070" class="elsevierStylePara elsevierViewall">Two sets of primers were specifically designed upstream of the promoter region to discriminate methylated from unmethylated alleles, using the Methprimer Software<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>).</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0075" class="elsevierStylePara elsevierViewall">The bisulfite modification was performed using the Epitect Bisulfite Kit (Qiagen Valencia, CA) to convert all unmethylated cytosines to uracils, while leaving methylated cytosines unaffected (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>).</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0080" class="elsevierStylePara elsevierViewall">Modified DNA was amplified in a total volume of 110<span class="elsevierStyleHsp" style=""></span>μL containing 1× NH4 buffer, 2<span class="elsevierStyleHsp" style=""></span>mM of MgCl<span class="elsevierStyleInf">2</span>, 200<span class="elsevierStyleHsp" style=""></span>μM of dNTPs, 1<span class="elsevierStyleHsp" style=""></span>U Taq DNA Polymerase (Bioline), different primer pair concentrations were used after optimization (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>), considering that we are working with FFPE tissue, an optimization procedure confers better results. PCR was performed for 40 cycles with annealing temperatures of 61<span class="elsevierStyleHsp" style=""></span>°C for 30<span class="elsevierStyleHsp" style=""></span>s and primer extension at 72<span class="elsevierStyleHsp" style=""></span>°C for 60<span class="elsevierStyleHsp" style=""></span>s using 50<span class="elsevierStyleHsp" style=""></span>ng bisulfite-modified DNA. All PCRs were performed with positive controls for both unmethylated and methylated alleles and no DNA control. DNA of healthy human lymphocytes served as positive control for methylated and unmethylated <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> state. The first was treated with Methyltransferase (CpG Methyltransferase M.SssI) (New England Biolabs), and subsequently submitted to sodium bisulfite transformation (Epitect Bisulfite, Qiagen), the second was only modified with sodium bisulphite. The CpG Methyltransferase, M.SssI, methylates all cytosine residues (C<span class="elsevierStyleSup">5</span>) within the double-stranded dinucleotide recognition sequence 5′…CG…3′.</p><p id="par0085" class="elsevierStylePara elsevierViewall">The PCR products were separated on a 4% agarose gel containing ethidium bromide and visualized under UV light, and its size estimated by comparison with a DNA Molecular Weight Marker XIII (50<span class="elsevierStyleHsp" style=""></span>bp ladder) (Roche).</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Statistical analysis</span><p id="par0090" class="elsevierStylePara elsevierViewall">The association between clinicopathological variables (pTNM, gender, age) and frequency of methylation and protein expression silencing among the tumour subtypes was assessed using the Pearson <span class="elsevierStyleItalic">χ</span><span class="elsevierStyleSup">2</span> and Fischer's exact test. All tests were two-sided and the level of significance was set at <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05.</p></span></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Results</span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Protein expression of MLH1 and MSH2 in tissue microarrays</span><p id="par0095" class="elsevierStylePara elsevierViewall">We investigated MLH1 and MSH2 expression using immunohistochemistry analysis in tissue microarrays comprising 80 primary NSCLC patients, that were respiratory epithelium, preneoplastic lesion (basal cell hyperplasia, metaplasia, dysplasia) and tumoural patterns. Following the explained score it was possible to define two definite groups, normal expression with >75%/+++ nuclear expression and the group with reduced expression <75%/++. After applying these scores, the internal control of lymphocytes had normal expression (data not shown) but tumour adjacent respiratory epithelium and parenchyma were considered reduced for both MLH1 and MSH2. Twenty-three cases (57%) of ADC for MLH1 expression and 27 cases (67%) for MSH2, had reduced expression; in SCC 29 cases (72%) for MLH1 expression and 25 cases (62%) for MSH2 expression had reduced expression.</p><p id="par0100" class="elsevierStylePara elsevierViewall">Co-reduction of both MLH1 and MSH2 was found in 38 cases (19 ADC and 19 SCCs), according with <a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>, probably due to different altered epigenetic or/and genetic mechanisms involved in down-regulation of gene expression. Tumour cells that exhibited an absence of nuclear staining in the presence of non-neoplastic cells and infiltrating lymphocytes with nuclear staining were considered to have an abnormal pattern.</p><p id="par0105" class="elsevierStylePara elsevierViewall">In normal respiratory epithelium reduced expression was found in 70% MLH1 and 75% MSH2 in ADC, and 100% MLH1 and 97% in MSH2 in SCC, to study this we would need cancer-free controls to explain the possible time required to acquire the additional genetic and epigenetic changes that promote tumour progression.</p><p id="par0110" class="elsevierStylePara elsevierViewall">Basal cell hyperplasia in cases of adenocarcinoma presented normal expression of MLH1 and MSH2. Squamous cell carcinomas revealed reduced expression of MLH1 and MSH2 in 72% and 62.5% respectively. <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a> represents the IHC expression heterogeneity.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070"><span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> methylation status in tumour samples</span><p id="par0115" class="elsevierStylePara elsevierViewall">We examined the promoter hypermethylation status of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> genes in 40 squaumous cell carcinoma and 33 adenocarcinoma using MSP assay in manually microdissected tissue. 40 DNA samples of squamous cell carcinoma and 33 samples of adenocarcinoma were analyzed (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>).</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0120" class="elsevierStylePara elsevierViewall">We observed two patterns of hypermethylation; the partial pattern was the most prevalent (58.33%) for the <span class="elsevierStyleItalic">MLH1</span> gene (M-U) while for the <span class="elsevierStyleItalic">MSH2</span> gene the hypermethylation fully pattern (M-M) was the one most verified (76.9%).</p><p id="par0125" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">MLH1</span> methylation pattern seems to vary substantially by histological type (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>). The prevalence of <span class="elsevierStyleItalic">MLH1</span> promoter hypermethylation was higher in squamous cell carcinoma (47.5%), with a correlation (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.003) between the histological subtype and the methylation status of the promoter of <span class="elsevierStyleItalic">MLH1</span> gene. The difference is not so obvious in <span class="elsevierStyleItalic">MSH2</span> promoter hypermethylation; however adenocarcinoma has the highest number of cases (42.4%). No correlation was found between histological subtype and methylation status of <span class="elsevierStyleItalic">MSH2</span> (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.2699).</p><p id="par0130" class="elsevierStylePara elsevierViewall">According to the relationship between the frequency of gender and histological subtype, women with adenocarcinoma as well as men with squamous cell carcinoma have a higher percentage of hypermethylation of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> promoters (<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>).</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Relationship between the methylation status and IHC protein expression</span><p id="par0135" class="elsevierStylePara elsevierViewall">According to the distribution of gene promoter methylation and loss of expression at tumour type in 80 patients, no statistical correlation was observed between the promoter methylation and expression levels in tumour samples, <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.09 for MLH1 and <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.894 for MSH2 (<a class="elsevierStyleCrossRefs" href="#tbl0025">Tables 5–7</a>).</p><elsevierMultimedia ident="tbl0025"></elsevierMultimedia><elsevierMultimedia ident="tbl0030"></elsevierMultimedia><elsevierMultimedia ident="tbl0035"></elsevierMultimedia><p id="par0140" class="elsevierStylePara elsevierViewall">Moreover, no correlation was found between <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> methylation levels and any of the clinicopathological characteristics considered (age, gender, TNM stage and tumour histological type) (<a class="elsevierStyleCrossRef" href="#tbl0035">Table 7</a>).</p><p id="par0145" class="elsevierStylePara elsevierViewall">We observed two patterns of hypermethylation; the partial pattern was the most prevalent (58.33%) for the <span class="elsevierStyleItalic">MLH1</span> gene (M-U) while for the <span class="elsevierStyleItalic">MSH2</span> gene the hypermethylation fully pattern (M-M) was the one most verified (76.9%).</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Discussion</span><p id="par0150" class="elsevierStylePara elsevierViewall">Most clinical studies, have recorded moderate to high elevation of MSH2 expression in sporadic tumours like colon, prostate or bladder while there is substantial reduction to near loss of functional MLH1 or MSH2 protein expression in ovarian, lung and stomach tumours relative to their matched normal tissues.<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11–13</span></a> Reduced expression of MLH1 and MSH2 was observed in respiratory epithelia, metaplasia and dysplasia. We know that cancer is a disease involving multiple pathways and genetic lesions, which are necessary for a tumour to become fully established. The story is the same for epigenetic lesions. It is difficult to explain the differential rates of progression of premalignant lesions and differences in behaviour of morphologically similar lesions. Heterogeneity for microsatellite instability (MSI) and promoter methylation in driving these phenomena forward may explain this; however, no previous analysis has examined this in detail.</p><p id="par0155" class="elsevierStylePara elsevierViewall">Alterations in expression of MMR proteins MLH1 and MSH2 have been reported in a variable proportion of NSCLC but very few studies have investigated the role of reduced protein expression in precursor lesions of NSCLC or have investigated their potential prognostic significance in invasive carcinomas. More recent studies have identified changes in methylation in the oral epithelium of smokers and linked these changes to bronchial epithelium.<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14,15</span></a></p><p id="par0160" class="elsevierStylePara elsevierViewall">We found differences concerning the pattern of methylation of <span class="elsevierStyleItalic">MLH1</span> gene depending on the histological typing of NSCLC (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.003) and within the subtype. Fifteen percent of the ADC cases showed hypermethylation of <span class="elsevierStyleItalic">MLH1</span> compared with 47.5% cases of methylated SCC. Although we found no significant differences in the methylation pattern of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> genes in SCC, ADC has a higher frequency of <span class="elsevierStyleItalic">MLH1</span> methylated rather than <span class="elsevierStyleItalic">MSH2</span>.</p><p id="par0165" class="elsevierStylePara elsevierViewall">In patients with ADC we also found basal cell hyperplasia that presents MLH1 and MSH2. Although this can be explained by the fact that the pathogenesis of adenocarcinoma is not related with the bronchus and therefore with basal cells, but with Clara Cells and type-II pneumonocytes, so basal cell hyperplasia and also metaplasia are not required to have reduced protein expression.<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a></p><p id="par0170" class="elsevierStylePara elsevierViewall">Females with adenocarcinoma were significantly more likely to have methylated <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> compared to males. Although, these differences were not observed in squamous cell carcinoma, males were more likely to have hypermethylation of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span>. These substantial differences have not been consistently noted in the literature,<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> at least on the genes under study, perhaps because few studies have been stratified by histological type when assessing hypermethylation differences by gender.<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> Since females are more likely to have adenocarcinomas compared to males, differences in hypermethylation frequency due to gender may have been obscured by differences due to histological type.<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a></p><p id="par0175" class="elsevierStylePara elsevierViewall">Hawes et al. mentioned in their recent work that substantial differences in hypermethylation by gender may suggest the possibility of differential pathways and/or risk factors for NSCLC between genders, with respect to risk factors, especially with regards to the effect of cigarette smoking as well as survival and effectiveness of treatment.<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17,18</span></a> Hormonal factors may account for these differences, although the mechanism that influences the methylation status in NSCLC remains unclear.<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a></p><p id="par0180" class="elsevierStylePara elsevierViewall">As in our study, Xinarianos et al.<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> and Cooper et al.,<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> did not find any correlation between reduced MLH1 and MSH2 expression and age, gender, tumour differentiation or TNM stage.</p><p id="par0185" class="elsevierStylePara elsevierViewall">Most of the studies used qualitative methylation-specific PCR in order to detect DNA methylation, a method that can sometimes lead to false positive results and does not distinguish between low and high level methylation. Furthermore, results in these studies have been inconsistent due to varying methylation detection protocols, PCR primers, and study populations, and none have comprehensively studied more than 10 genes.<a class="elsevierStyleCrossRefs" href="#bib0080"><span class="elsevierStyleSup">16,17</span></a></p><p id="par0190" class="elsevierStylePara elsevierViewall">The variability in results that we observed is probably due to a number of technical factors, such as assay-specific differences including target sites of CpG island loci, primers and the conditions of sodium bisulfite modification. Promoter hypermethylation is one of the mechanisms responsible for the genes silencing,<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> although in this work no correlation was found between <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> promoter methylation and IHC expression in tumour samples (<a class="elsevierStyleCrossRefs" href="#tbl0030">Tables 6 and 7</a>).</p><p id="par0195" class="elsevierStylePara elsevierViewall">To better understand the role of MMR system in the tumourigenesis of carcinomas of the lung, we conclude that there is a real need for a more robust study covering the differences inherent to tumour histology, heterogeneity and preservation, and finally differences in the study population (age, gender and number of subtyped cases beyond NSCLC), to elucidate other possible mechanisms of altered expression of the <span class="elsevierStyleItalic">hMLH1</span> and <span class="elsevierStyleItalic">hMSH2</span>, including loss of heterozygosity, chromosomal instability and imbalance mutations in genes of the MMR system,<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> and alterations in mRNA transcription.</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Ethical disclosures</span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Protection of human and animal subjects</span><p id="par0200" class="elsevierStylePara elsevierViewall">The authors declare that no experiments were performed on humans or animals for this study.</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Confidentiality of data</span><p id="par0205" class="elsevierStylePara elsevierViewall">The authors declare that they have followed the protocols of their work centre on the publication of patient data and that all the patients included in the study received sufficient information and gave their written informed consent to participate in the study.</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Right to privacy and informed consent</span><p id="par0210" class="elsevierStylePara elsevierViewall">The authors declare that no patient data appear in this article.</p></span></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Funding</span><p id="par0215" class="elsevierStylePara elsevierViewall">Funded by a grant from <span class="elsevierStyleGrantSponsor" id="gs0005">CIMAGO, Faculty of Medicine, University of Coimbra, Portugal</span>.</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Conflicts of interest</span><p id="par0220" class="elsevierStylePara elsevierViewall">The authors have no conflicts of interest to declare.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:2 [ "identificador" => "xres305085" "titulo" => "Abstract" ] 1 => array:2 [ "identificador" => "xpalclavsec288231" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xres305086" "titulo" => "Resumo" ] 3 => array:2 [ "identificador" => "xpalclavsec288230" "titulo" => "Palavras chave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Patients and tissue samples" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Tissue microarrays building" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Analysis of protein expression: immunohistochemistry" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Methylation-specific polymerase chain reaction assay for the hMLH1 and hMSH2 genes" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0040" "titulo" => "Results" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0045" "titulo" => "Protein expression of MLH1 and MSH2 in tissue microarrays" ] 1 => array:2 [ "identificador" => "sec0050" "titulo" => "MLH1 and MSH2 methylation status in tumour samples" ] 2 => array:2 [ "identificador" => "sec0055" "titulo" => "Relationship between the methylation status and IHC protein expression" ] ] ] 7 => array:2 [ "identificador" => "sec0060" "titulo" => "Discussion" ] 8 => array:3 [ "identificador" => "sec0065" "titulo" => "Ethical disclosures" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0070" "titulo" => "Protection of human and animal subjects" ] 1 => array:2 [ "identificador" => "sec0075" "titulo" => "Confidentiality of data" ] 2 => array:2 [ "identificador" => "sec0080" "titulo" => "Right to privacy and informed consent" ] ] ] 9 => array:2 [ "identificador" => "sec0085" "titulo" => "Funding" ] 10 => array:2 [ "identificador" => "sec0090" "titulo" => "Conflicts of interest" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2012-04-27" "fechaAceptado" => "2013-07-29" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec288231" "palabras" => array:6 [ 0 => "Adenocarcinoma" 1 => "Squamous cell carcinoma" 2 => "Lung" 3 => "Hypermethylation" 4 => "<span class="elsevierStyleItalic">MLH1</span>" 5 => "<span class="elsevierStyleItalic">MSH2</span>" ] ] ] "pt" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palavras chave" "identificador" => "xpalclavsec288230" "palabras" => array:6 [ 0 => "Adenocarcinoma" 1 => "Carcinoma das células escamosas" 2 => "Pulmão" 3 => "Hipermetilação" 4 => "<span class="elsevierStyleItalic">MLH1</span>" 5 => "<span class="elsevierStyleItalic">MSH2</span>" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Five years survival of lung cancer is 16%, significantly lower than in prostate (99.9%), breast (88.5%) and colon (64.1%) carcinomas. When diagnosed in the surgical stage it increases to 50% but this group only comprises 14–16% of the cases. DNA methylation has emerged as a potential cancer-specific biomarker. Hypermethylation of CpG islands located in the promoter regions of tumour suppressor genes is now firmly established as an important mechanism for gene inactivation.</p><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">This retrospective study included 40 squamous cell carcinomas and 40 adenocarcinomas in various surgical TNM stages to define methylation profile and possible silencing of DNA repair genes – <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> – using Methylation-Specific PCR and protein expression by immunohistochemistry in tumoural tissue, preneoplastic lesions and respiratory epithelium with normal histological features.</p><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The protein expression of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> genes, in the available preneoplastic lesions and in normal cylindrical respiratory epithelium appeared reduced. The frequency of promoter hypermethylation found on these DNA repair genes was elevated, with a higher prevalence of methylation of <span class="elsevierStyleItalic">MLH1</span> gene in 72% of squamous cell carcinoma. The differences are not so obvious for <span class="elsevierStyleItalic">MSH2</span> promoter hypermethylation. No correlation was found among the status of methylation, the protein expression and the clinicopathological characteristics.</p><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">With a larger study, a better characterization of the hypermethylation status of neoplastic and preneoplastic lesions in small biopsies would be achieved, inherent to tumour histology, heterogeneity and preservation, and finally differences in the study population to elucidate other possible mechanisms of altered expression of the <span class="elsevierStyleItalic">hMLH1</span> and <span class="elsevierStyleItalic">hMSH</span>.</p>" ] "pt" => array:2 [ "titulo" => "Resumo" "resumen" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">A sobrevivência aos cinco anos no cancro do pulmão é de 16%, significativamente inferior que nos carcinomas na próstata (99,9%), mama (88,5%) e cólon (64,1%). Quando diagnosticado na fase cirúrgica aumenta até 50%, mas este grupo é apenas constituído por 14-16% dos casos. A metilação do ADN surgiu como um potencial marcador biológico específico do cancro. A hipermetilação das ilhas CpG localizadas nas regiões promotoras de genes supressores do tumor está agora firmemente estabelecida como um mecanismo importante para a inativação do gene.</p><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Este estudo retrospetivo incluiu 40 carcinomas das células escamosas e 40 adenocarcinomas em vários estádios cirúrgicos TNM para definir o perfil da metilação e o possível silenciamento de genes de reparação do ADN - <span class="elsevierStyleItalic">MLH1</span> e <span class="elsevierStyleItalic">MSH2</span> - usando metilação PCR específica e expressão da proteína por imuno-histoquímica no tecido tumoral, lesões pré-neoplásicas e epitélio respiratório com características histológicas normais.</p><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">A expressão da proteína dos genes <span class="elsevierStyleItalic">MLH1</span> e <span class="elsevierStyleItalic">MSH2</span>, nas lesões pré-neoplásticas disponíveis e no epitélio respiratório cilíndrico normal, pareceu reduzida. A frequência da hipermetilação promotora encontrada nestes genes reparadores de ADN foi elevada, com uma maior prevalência da metilação do gene <span class="elsevierStyleItalic">MLH1</span> em 72% de carcinoma de células escamosas. As diferenças não são tão óbvias para a hipermetilação do promotor <span class="elsevierStyleItalic">MSH2</span>. Não foi encontrada correlação entre o estado de metilação, a expressão da proteína e as características clínico-patológicas.</p><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Com um estudo mais amplo, seria alcançada uma melhor caracterização do estado da hipermetilação das lesões neoplásicas e pré-neoplásicas em pequenas biopsias, inerente à histologia, heterogeneidade e preservação do tumor, e, finalmente, às diferenças na população estudada para elucidar outros mecanismos possíveis da expressão alterada do <span class="elsevierStyleItalic">hMLH1</span> e <span class="elsevierStyleItalic">hMSH</span>.</p>" ] ] "multimedia" => array:8 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1802 "Ancho" => 1501 "Tamanyo" => 767764 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">MLH1 IHC expression in one mixed type adenocarcinoma, (A) basel cell hyperplasia, (B) acinar pattern with reduced expression (−), (C) bronchioloalveolar pattern with normal expression (+++) and (D) solid pattern with reduced expression (++); MSH2 IHC expression in epidermoid carcinoma in situ and (E) corresponding epidermoid carcinoma (F) 200×.</p>" ] ] 1 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Gene \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Sequence \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Tm (°C) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">G/C (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Conc. (μM) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Amplicon (Bp) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">MSH2</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">M Forward \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">63.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ TCGTGGTCGGACGTCGTTC 3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">56.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">114 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">M Reverse \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ CAACGTCTCCTTCGACTACACCG 3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U Forward \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">41.7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ GGTTGTTGTGGTTGGATGTTGTTT 3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">63.9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">41.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">123 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U Reverse \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ CAACTACAACATCTCCTTCAACTACACCA 3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="6" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">MLH1</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">M Forward \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ ACGTAGACGTTTTATTAGGGTCGC 3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">61.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">131 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">M Reverse \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′-CCTCATCGTAACTACCCGCG-3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U Forward \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">58.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">27.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ TTTTGATGTAGATGTTTTATTAGGGTTG-3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">61.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">142 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">U Reverse \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5′ ACCACCTCATCATAACTACCCACA 3′ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451519.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">MLH1 and MSH2 primer concentrations after optimization.</p>" ] ] 2 => array:7 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">n.o., not observed; normal expression 75%/+++; reduced expression positivity below 75%/−.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="4" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Adenocarcinoma</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="4" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Squamous cell carcinoma</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">MLH1 expression</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">MSH2 expression</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">MLH1 expression</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">MSH2 expression</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Normal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Reduced \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Normal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Reduced \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Normal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Reduced \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Normal \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Reduced \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Respiratory epithelium/parenchyma \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7/24 (29.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17/24 (70.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6/24 (25%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18/24 (75%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/35 (0%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35/35 (100%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1/36 (2.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35/36 (97.2%) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Basal cell hyperplasia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10/17 (58.8%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7/17 (41.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7/11 (63.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4/11 (36.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1/6 (16.7%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5/6 (83.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0/6 (0%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6/6 (100%) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Epidermoid metaplasia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">n.o. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">n.o. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">n.o. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">n.o. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5/17 (29.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12/17 (70.6%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8/17 (47.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9/17 (52.9%) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tumour \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17/40 (42.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23/40 (57.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13/40 (32.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">27/40 (67.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11/40 (27.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29/40 (72.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15/40 (37.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">25/40 (62.5%) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451521.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">MLH1 and MSH2 positive immunohistochemistry expression in carcinogenesis progression achieved in tissue microarrays.</p>" ] ] 3 => array:7 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">White grey denotes unmethylated and normal protein expression respectively, dark grey methylated promoter genes. M, male; F, female; ADC, adenocarcinoma; SCC, squamous cell carcinoma; T, tumour size; N, local metastasis; M, distant metastasis; n.a., not available; n.d., not determined.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleInlineFigure"><elsevierMultimedia class="elsevierStyleLink" ident="fx1"></elsevierMultimedia></span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleInlineFigure"><elsevierMultimedia class="elsevierStyleLink" ident="fx2"></elsevierMultimedia></span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleInlineFigure"><elsevierMultimedia class="elsevierStyleLink" ident="fx3"></elsevierMultimedia></span> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451518.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Clinicopathological distribution of gene promoter methylation and loss of expression at tumour type in 80 patients. Patient's age ranging 64.9<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>9.88 years (63.4 years – adenocarcinoma 66.55 years – squamous cell carcinoma), 28 females and 52 males.</p>" ] ] 4 => array:7 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">ADC (<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>33) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">SCC (<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>40) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">MLH1</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (15.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19 (47.5%) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">MSH2</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14 (42.4%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 (30%) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451522.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Promoter hypermethylation frequency in NSCLC in tumour tissues, by histological types.</p>" ] ] 5 => array:7 [ "identificador" => "tbl0025" "etiqueta" => "Table 5" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">ADC</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">SCC</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Female (<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>19) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Male (<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>14) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Female (<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Male (<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>36) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">MLH1</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4 (80%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 (20%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2 (10.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 (89.5%) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">MSH2</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">8 (57.1%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (42.9%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 (25%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 (75%) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451524.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">Frequency of promoter hypermethylation in NSCLC tumour tissue, by histological type and gender.</p>" ] ] 6 => array:7 [ "identificador" => "tbl0030" "etiqueta" => "Table 6" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IHC expression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">MLH1</span> promoter hypermethylation</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">MSH2</span> promoter hypermethylation</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">U \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">U \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Normal expression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reduced expression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">P</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.09</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.894</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451523.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">Correlation between MLH1 and MSH2 promoter hypermethylation and its possible interference in respective immunohistochemistry expression.</p>" ] ] 7 => array:7 [ "identificador" => "tbl0035" "etiqueta" => "Table 7" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Age \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Gender \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">TNM stage \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">NSCLC</span></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>MLH1 loss expression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.319 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.555 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.988 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>MLH1 methylation \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.077 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.920 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.133 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>MSH2 loss expression \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.669 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.555 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.189 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>MSH2 methylation \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.737 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.139 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.562 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab451520.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">Correlation of <span class="elsevierStyleItalic">MLH1</span> and <span class="elsevierStyleItalic">MSH2</span> methylation levels and respective protein expression in relation to the clinicopathological variables of NSCLC tumours (age, gender and TNM stage).</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:20 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The epigenetics of cancer etiology" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A.P. Feinberg" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.semcancer.2004.06.005" "Revista" => array:6 [ "tituloSerie" => "Semin Cancer Biol" "fecha" => "2004" "volumen" => "14" "paginaInicial" => "427" "paginaFinal" => "432" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15489135" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pathogenesis of lung cancer signalling pathways: roadmap for therapies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E. Brambilla" 1 => "A. Gazdar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1183/09031936.00014009" "Revista" => array:6 [ "tituloSerie" => "Eur Respir J" "fecha" => "2009" "volumen" => "33" "paginaInicial" => "1485" "paginaFinal" => "1497" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19483050" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aberrant DNA methylation as a cancer-inducing mechanism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Esteller" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1146/annurev.pharmtox.45.120403.095832" "Revista" => array:6 [ "tituloSerie" => "Annu Rev Pharmacol Toxicol" "fecha" => "2005" "volumen" => "45" "paginaInicial" => "629" "paginaFinal" => "656" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15822191" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA methylation disturbances as novel therapeutic target in lung cancer: preclinical and clinical results" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "W. Digel" 1 => "M. Lübbert" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.critrevonc.2005.02.002" "Revista" => array:6 [ "tituloSerie" => "Crit Rev Oncol Hematol" "fecha" => "2005" "volumen" => "55" "paginaInicial" => "1" "paginaFinal" => "11" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15886007" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aberrant methylation of H-Cadherin (CDH13) promoter is associated with tumor progression in primary nonsmall cell lung carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.S. Kim" 1 => "J. Han" 2 => "Y.M. Shim" 3 => "J. Park" 4 => "D.-H. Kim" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Am Cancer Soc" "fecha" => "2005" "volumen" => "104" "paginaInicial" => "1825" "paginaFinal" => "1833" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of epigenetic aberrant promoter methylation in serum DNA is useful for early detection of lung cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Fujiwara" 1 => "N. Fujimoto" 2 => "M. Tabata" 3 => "K. Nishii" 4 => "K. Matsuo" 5 => "K. Hotta" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Cancer Res" "fecha" => "2005" "volumen" => "11" "paginaInicial" => "1219" "paginaFinal" => "1225" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15709192" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pathology and genetics of tumours of the lung, pleura, thymus and heart, WHO Classification of Tumours" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W.D. Travis" 1 => "E. Brambilla" 2 => "H.K. Müller-Hermelink" 3 => "C.C. Harris" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "2004" "editorial" => "IARC Press" "editorialLocalizacion" => "Lyon" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TNM classification of malignant tumours" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H. Sobin Leslie" 1 => "M.K. Gospodarowicz" 2 => "C. Wittekind" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "edicion" => "7th ed." "fecha" => "2009" "editorial" => "Wiley-Blackwell" "editorialLocalizacion" => "Oxford, UK" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Methylation-specific PCR a novel PCR assay for methylation status of CpG islands" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.G. Herman" 1 => "J.R. Graff" 2 => "S. Myöhänen" 3 => "B.D. Nelkin" 4 => "S.B. Baylin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci U S A" "fecha" => "1996" "volumen" => "93" "paginaInicial" => "9821" "paginaFinal" => "9826" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8790415" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "designing primers for methylation PCRs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L.C. Li" 1 => "R. Dahiya" 2 => "Methprimer:" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Bioinformatics" "fecha" => "2002" "volumen" => "18" "paginaInicial" => "1427" "paginaFinal" => "1431" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12424112" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Potential of 5-aza-2′-deoxycytidin (Decitabine) a potent inhibitor of DNA methylation for therapy of advanced non-small cell lung cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R.L. Momparler" 1 => "J. Ayoub" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Lung Cancer" "fecha" => "2001" "volumen" => "34" "paginaInicial" => "S111" "paginaFinal" => "S115" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11742714" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A phase I trial of cisplatin plus decitabine, a new DNA-hypomethylating agent, in patients with advanced solid tumours and a follow-up early phase II evaluation in patients with inoperable non-small cell lung cancer" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Schwartsmann" 1 => "H. Schunemann" 2 => "C.N.F. Gorini" 3 => "A.F. Ferreira Filho" 4 => "C. Garbino" 5 => "G. Sabini" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Invest New Drugs" "fecha" => "2000" "volumen" => "18" "paginaInicial" => "83" "paginaFinal" => "91" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10830142" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evaluation of a 7-day continuous intravenous infusion of decitabine: inhibition of promoter-specific and global genomic DNA methylation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "W.E. Samlowski" 1 => "S.A. Leachman" 2 => "M. Wade" 3 => "P. Cassidy" 4 => "P. Porter-Gill" 5 => "L. Busby" 6 => "R. Wheeler" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1200/JCO.2005.06.118" "Revista" => array:6 [ "tituloSerie" => "J Clin Oncol" "fecha" => "2005" "volumen" => "23" "paginaInicial" => "3897" "paginaFinal" => "3905" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15753459" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Phenotypic mismatch repair hMSH2 and hMLH1 gene expression profiles in primary non-small cell lung carcinomas" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Vageli" 1 => "Z. Daniil" 2 => "J. Dahabreh" 3 => "E. Karagianni" 4 => "D.N. Vamvakopoulou" 5 => "M.G. Ioannou" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.lungcan.2008.09.018" "Revista" => array:6 [ "tituloSerie" => "Lung Cancer" "fecha" => "2009" "volumen" => "64" "paginaInicial" => "282" "paginaFinal" => "288" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19056144" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oral epithelium as a surrogate tissue for assessing smoking-induced molecular alterations in the lungs" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "M. Bhutani" 1 => "A.K. Pathak" 2 => "Y.H. Fan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Cancer Prev Res" "fecha" => "2008" "volumen" => "1" "paginaInicial" => "39" "paginaFinal" => "44" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA hypermethylation of tumors from non-small cell lung cancer (NSCLC) patients is associated with gender and histologic type" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.E. Hawes" 1 => "J.E. Stern" 2 => "Q. Feng" 3 => "Q. Wiens" 4 => "L.W. Wiens" 5 => "J.S. Rasey" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.lungcan.2009.11.002" "Revista" => array:6 [ "tituloSerie" => "Lung Cancer" "fecha" => "2010" "volumen" => "69" "paginaInicial" => "172" "paginaFinal" => "179" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19945765" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Women with pathologic state I, II and III non-small cell lung cancer have better survival than men" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Rj Cerfolio" 1 => "A.S. Bryant" 2 => "E. Scott" 3 => "M. Sharma" 4 => "F. Robert" 5 => "S.A. Spencer" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.130.6.1796" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2006" "volumen" => "130" "paginaInicial" => "1796" "paginaFinal" => "1802" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17166999" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gender differences in non-small cell lung cancer: a population based study" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Caldarella" 1 => "E. Crocetti" 2 => "C.E. Comin" 3 => "A. Janni" 4 => "Pegna Al" 5 => "E. Paci" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejso.2007.01.001" "Revista" => array:6 [ "tituloSerie" => "Eur J Surg Oncol" "fecha" => "2007" "volumen" => "33" "paginaInicial" => "763" "paginaFinal" => "768" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17306497" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "hMLH1 hMSH2 expression correlates with allelic imbalance on chromosome 3p in non-small cell lung carcinomas" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "G. Xinarianos" 1 => "T. Liloglou" 2 => "W. Prime" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Cancer Res" "fecha" => "2000" "volumen" => "60" "paginaInicial" => "4216" "paginaFinal" => "4221" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10945633" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prognostic significance of DNA repair proteins MLH1, MSH2 and MGMT expression in non-small cell lung cancer and precursor lesions" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:7 [ 0 => "W.A. Cooper" 1 => "M.R.J. Kohonen-Corish" 2 => "C. Chan" 3 => "S.Y. Kwun" 4 => "B. McCaughan" 5 => "C. Kennedy" 6 => "R.L. Sutherland" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2559.2008.02999.x" "Revista" => array:6 [ "tituloSerie" => "Histopathology" "fecha" => "2008" "volumen" => "52" "paginaInicial" => "613" "paginaFinal" => "622" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18370958" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/21735115/0000002000000001/v1_201401230023/S2173511514000104/v1_201401230023/en/main.assets" "Apartado" => array:4 [ "identificador" => "9710" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/21735115/0000002000000001/v1_201401230023/S2173511514000104/v1_201401230023/en/main.pdf?idApp=UINPBA00004E&text.app=https://journalpulmonology.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2173511514000104?idApp=UINPBA00004E" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 17 | 10 | 27 |
| 2024 October | 48 | 44 | 92 |
| 2024 September | 34 | 33 | 67 |
| 2024 August | 39 | 36 | 75 |
| 2024 July | 41 | 29 | 70 |
| 2024 June | 28 | 32 | 60 |
| 2024 May | 31 | 38 | 69 |
| 2024 April | 32 | 36 | 68 |
| 2024 March | 31 | 36 | 67 |
| 2024 February | 28 | 35 | 63 |
| 2024 January | 19 | 31 | 50 |
| 2023 December | 29 | 45 | 74 |
| 2023 November | 17 | 31 | 48 |
| 2023 October | 26 | 36 | 62 |
| 2023 September | 19 | 38 | 57 |
| 2023 August | 20 | 21 | 41 |
| 2023 July | 14 | 33 | 47 |
| 2023 June | 15 | 20 | 35 |
| 2023 May | 22 | 21 | 43 |
| 2023 April | 21 | 14 | 35 |
Show all
